CLONING AND EXPRESSION ANALYSIS OF BETAINE ALDEHYDE DEHYDROGENASE FROM Pseudomonas fluorescens

Abstract

Genomic DNA was isolated from Pseudomonas fluorescens using Wizard® Genomic DNA Purification Kit (Promega). Amplification of betB was performed using its specific oligonucleo-tide primers (5`ggaattccatatggcccgtttcgaactgcaaaaactc3`, and 5`aagcttttagaacaccgaggcgtagtcgcccag3`). The PCR fragment of betB (1.5 kb) was purified from the agarose gel using QIAquick PCR Purification Kit (Qiagen). Cloning of the PCR fragment was per- CLONING AND EXPRESSION ANALYSIS OF pfBADH 163 formed using the pGEM T-Easy cloning kit (Promega). The construct was used to transform the E. coli strain DH5α (Stratagene). After selecting the white clones, the construct was isolated using Wizard® Plus SV® Minipreps DNA Puri-fication System (Promega). The positive transformants were sequenced at JenaGen labs Corporation, Germany. The betB clone was digested with NdeI and HindIII, and ligated into pCAL-n vector (Stratagene). The resulting construct des-ignated as pCAL-betB was used to trans-form the E. coli strain XL1-blue (Stratagene), the positive transformants were selected and DNA sequencing was performed at JenaGen labs Corporation, Germany. Total protein was extracted from control and transformed E. coli after IPTG induction. The induced level of the BADH was assessed by sodium docecyl sulfate polyacrylamide gel electrophoresis (SDS -PAGE). One μg of total soluble protein from the control and transformed E. coli was separated on 8% SDS-PAGE gel (Sambrook et al., 2005). Sequence analysis The PfBADH clone was sequenced using a Big Dye Terminator Cycle Se-quencing FS Ready Reaction Kit (Applied Biosystems, Foster City, CA) and an ABI PRISM 310 DNA sequencer (Applied Biosystems). A homology search was per-formed using BLASTX against the NCBI protein database (http://www.ncbi. nlm.nih.gov). Sequences of plant and mi-cro organisms BADH proteins that showed similarity to the PfBADH protein were obtained from the NCBI nonredundant and dbEST data sets using BLASTX or BLASTP (ver. 2.0.10) (Altschul et al., 1997). The full amino acid sequences of the proteins were aligned using CLUSTAL W ver. 1.8 (Thompson et al., 1994) and subjected to phylogenetic analysis. Phylogenic trees were constructed using the neighbor-joining (NJ) method (Saitou and Nei, 1987) with parsimony and heuristic search criteria and 1000 bootstrap replications to assess branching confidence.